10x nebuffer 2 (New England Biolabs)
New England Biolabs is a verified supplier 
New England Biolabs manufactures this product 
99
Structured Review
New England Biolabs
10x nebuffer 2
10x Nebuffer 2, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 420 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/10x+nebuffer+2+1/NEBuffer+r2%2E1/pmc13092967-104-13-14
Average 99 stars, based on 420 article reviews
10x Nebuffer 2, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 420 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/10x+nebuffer+2+1/NEBuffer+r2%2E1/pmc13092967-104-13-14
Average 99 stars, based on 420 article reviews
10x nebuffer 2 - by Bioz Stars,
2026-09
99/100 stars
Images
Related Articles
Concentration Assay:Article Title: Plasminogen activator inhibitors orchestrate the immunosuppressive tumor microenvironment in pancreatic cancer Article Snippet: .. For annealing, forward and reverse oligos were mixed to a final concentration of 2 μM, combined with Incubation:Article Title: Inter-chromosomal transcription hubs shape the 3D genome architecture of African trypanosomes. Article Snippet: .. For polyadenylation, 5 μL of other:Article Title: Pooled CRISPRi screening reveals fungal-specific vulnerabilities across environments and genetic backgrounds Article Snippet: Each reaction consisted of 1 μL (1 μg/μL) of ssDNA (oligo pool), 1 μL of primer (pRS 596) 5’ AAGCTTAATTAAAAGCTCTTC 3’ (equimolar amount of primer, 318.18 ng/μL), 41 μL of Nuclease-free water and 5 μL of Article Title: Argonaute-HNH filaments triggered by invader DNA confer bacterial immunity. Article Snippet: The samples were treated with 2 l of 3 U/l T4 DNA polymerase (NEB), 2.5 l of 10 U/l T4 polynucleotide kinase (NEB), 0.5 l of 5 U/l, CRISPR:Article Title: LbCas12a-based DNA POCT facilitates fast genotyping on farm. Article Snippet: Clustered regularly interspaced short palindromic repeats/CRISPR-associated protein 12a (CRISPR/Cas12a) detection system is now widely used for nucleic acid detection and disease diagnosis.. However, there are still fewer detections for single nucleotide polymorphisms (SNPs) and limited diversified detection systems for pathogen and SNP sites detection, which greatly limits their applications.. Obviously, the development of a more diversified and convenient suite of detection tools is essential to unlock the full potential of CRISPR/Cas12a technology and to expand its applications across a wider range of scenarios. Recombinase Polymerase Amplification:Article Title: LbCas12a-based DNA POCT facilitates fast genotyping on farm. Article Snippet: Clustered regularly interspaced short palindromic repeats/CRISPR-associated protein 12a (CRISPR/Cas12a) detection system is now widely used for nucleic acid detection and disease diagnosis.. However, there are still fewer detections for single nucleotide polymorphisms (SNPs) and limited diversified detection systems for pathogen and SNP sites detection, which greatly limits their applications.. Obviously, the development of a more diversified and convenient suite of detection tools is essential to unlock the full potential of CRISPR/Cas12a technology and to expand its applications across a wider range of scenarios. Purification:Article Title: Generation of cloned sheep lacking galactose-α1,3-galactose and N-glycolylneuraminic acid antigens Article Snippet: .. Briefly, PX330 was digested with BbsI in Agarose Gel Electrophoresis:Article Title: Generation of cloned sheep lacking galactose-α1,3-galactose and N-glycolylneuraminic acid antigens Article Snippet: .. Briefly, PX330 was digested with BbsI in Isolation:Article Title: Generation of cloned sheep lacking galactose-α1,3-galactose and N-glycolylneuraminic acid antigens Article Snippet: .. Briefly, PX330 was digested with BbsI in |